MOLECULAR TOOLS FOR EVOLUTIONARY AND POPULATION BIOLOGY  
- AKA "MOLECULAR EVOLUTION"

INTRODUCTION

This is a lab course. The goal is to learn molecular genetic techniques and computer analysis techniques (bioinformatics) that are used to test hypotheses about molecular evolution or test hypotheses about population-level phenomena. In this course I have attempted to keep the theoretical details of molecular evolution basic and simple. There is an entire molecular evolution lecture course that deals with these theoretical aspects in detail. This lab and bioinformatics course is largely based on the proposition that you learn by doing. You will learn basic molecular genetic techniques by doing a series of projects, often based on various analyses of your own DNA. Computer-based analysis tools will be learned through a series of homework exercises and demonstrations. The projects represent interesting problems involving molecular data that are current areas of scientific investigation. An overview of the techniques, analysis tools and projects follow.

LAB SKILLS AND TECHNIQUES TO BE MASTERED INCLUDE:

Pipetting

Centrifugation

Reagent/buffer/media preparation

DNA extraction

Restriction digestion and restriction mapping

Agarose and acrylamide gel electrophoresis

Polymerase chain reaction (PCR)

Microbial (aseptic) culture techniques

Cloning in microbial plasmid vectors

Plasmid preparations

Sequencing (template preparation for automated sequencing)

Microsatellite genotyping for parentage and forensic analysis

COMPUTER ANALYSIS TOOLS INCLUDE:

Pubmed – Scientific literature database

Genbank – database of DNA and protein sequences

BLAST – a sequence similarity searching tool

Restriction Site Analysis – a restriction endonuclease analysis program

PRIMER - PCR primer design

Sequencher – a sequence manipulation and evaluation program

Clustal – a multiple sequence alignment program

PAUP – a program for constructing phylogenetic trees

MacClade – a program for analyzing character evolution and manipulating and evaluating phylogenetic trees

KINSHIP – a program for evaluating relatedness from genetic data

SNAP – a program to test for diversifying selection using a synonymous/non-synonymous substitution analysis

PROJECT OVERVIEWS:

Restriction Digests of Lambda Phage

Restriction endonuclease enzymes cut DNA at specific DNA sequence sites. They generally function as a bacterial immune system by degrading viral genomes. Their discovery was critical to the development of recombinant DNA technology, because they were the first tool that allowed DNA to be cut at specific sites. Two restriction enzymes will be used to cut Lambda phage DNA. The entire genome of Lambda will be downloaded from Genbank and computer-based restriction analysis for the two restriction enzymes will be conducted. The resulting restriction fragments will be used as size markers on agarose and acrylamide gels throughout the rest of the course.

Experimental Evolution of Streptomycin Resistance and Compensatory Mutations

Evolution is usually thought to occur so slowly that it can only be studied indirectly. Over the past decade this notion has proven false as it has been shown that evolution can occur rapidly enough to be studied in real time experiments. We will study the experimental evolution of antibiotic (streptomycin) resistance in the bacteria Salmonella. We will also study the troubling observation that resistant bacteria can evolve compensatory mutations that remove the initial cost of resistance, making antibiotic resistance stable in the pathogen. The evolution of antibiotic resistance is a major problem for humans as antibiotic resistance is evolving in human pathogens at a much higher rate than the discovery of new antibiotics.

My DNA Extraction

You will each extract DNA from your own cells collected from cheek scrapings. These genomic DNAs will be used in the following two projects.

Cloning and Sequencing MHC DQα1 Genes and Mitochondria

Everyone will PCR amplify their own MHC (major histocompatibility complex) DQα1 gene and a segment of the mitochondrial D loop. The PCR products from mitochondria will be directly sequenced and those for MHC will be cloned into the plasmid pUC. (Note: Cloning technology is arguably the other major advance (after restriction enzymes) that allowed the molecular genetic revolution to take off in the 1970s). These plasmids will be prepared for sequencing. The resulting sequence information will be distributed to all class members who will then construct phylogenetic trees, including sequences from great apes, neanderthals and humans downloaded from Genbank. The phylogenetic trees for the MHC and mitochondrial genes will differ dramatically and you might find the results profound. The MHC sequences will also be analyzed for indications of diversifying selection.

Genetic Fingerprinting with Microsatellite Loci: CSI Bio3125

There are tens of thousands of microsatellite loci scattered throughout the genome. Microsatellite loci contain a tandemly repreated di, tri or tetra nucleotide motif. For example, the sequence gcactctctctctctctgaatc is a ct dinucleotide microsatellite with 7 repeats. These loci have a high mutation rate where the number of tandemly repeated units change. Consequently, they are highly polymorphic and thus become useful genetic markers that have revolutionized both population studies and forensics. For example, about 25 years ago we believed most avian species were monogamous, because socially they acted monogamous. We now know using genetic markers that the opposite is true; about 90% are polygynous or polyandrous. The now well known example from forensics is that many criminals are convicted largely on DNA evidence, but more importantly, many accused/convicted innocent people have been exonerated based on DNA evidence. It has revealed how inaccurate the justice system has been.

Using genomic DNA from your cheek DNA extractions (coded) and from one or more planted families, you will microsatellite genotype all individuals and apply the data to the following problems: Parentage / relatedness study - You suspect there are one or more families (parents and offspring) among a group of individuals, such as might occur in a wolf pack or post-breeding swallow assemblage. You will use your combined microsatellite data to identify the first degree relatives by comparing the proportion of allele sharing between pairs of individuals. This will be accomplished both by inspection and by using the RELATEDNESS program by Goodnight and Quellar. You will then attempt to determine who the parents and kids are from the genetic data?

We will also conduct a forensic study where we attempt to identify the murderer/rapist from a tissue sample taken from the crime scene. We will calculate the probability that there is another individual with this genotype in the population defined by genotypes found in the class.